YSD-C-2u and pYSD-N-2u are yeast display vectors for scFv display on the surface of yeast strain EBY100. pYSD-C/N-2u displays scFv fused to the C/N terminal of AGA2 through GS linker (Figure 1). The origin of replication 2 micron allows for ~50 copies per cell, which may make yeast colony PCR easier. The scFv display level and binding affinity by pYSD-C and pYSD-C-2u are similar, and slightly better than pYSD-N and pYSD-N-2u (Figure 2 and Table 1).

Figure 1. Schematic representation of scFv yeast display by pYSD-C-2u and pYSD-N-2u.

Figure 2. Flow cytometry assay of scFv yeast display by pYSD-C, pYSD-N, pYSD-C-2u, and pYSD-N-2u.
Table 1. Flow cytometry analysis of scFv yeast display by pYSD-C, pYSD-N, pYSD-C-2u, and pYSD-N-2u.
| Geometric Mean | ||
GFP (display) | APC (binding) | APC/GFP | |
pYSD-C (YD001C) | 1947 | 1556 | 0.80 |
pYSD-C-2u (YD002C) | 2087 | 1652 | 0.79 |
pYSD-N (YD001N) | 1566 | 980 | 0.63 |
pYSD-N-2u (YD002N) | 1927 | 1236 | 0.64 |
Conclusion: the high copy vectors didn't increase the display level, and vectors YD001 and YD002 showed similar display levels and binding affinities.
Even though constitutive promoter TEF1 is used in pYSD-C/N-2u, Galactose medium (Teknova #2S0542 or C9115) is still required for the surface display because AGA2 binds AGA1 and AGA1 is under the Gal1 promoter. When Glucose medium (Teknova #2S0540 or C8130) is used, AGA1 expression is compromised, antibody-AGA2 fusion proteins will be secreted into the culture medium.

Figure 3. The effect of glucose and galactose on antibody display and binding affinity.
Table 2. Specifications of pYSD-C/N-2u
Application | Yeast surface display |
Promoter | TEF1 |
Bacterial replication origin | ColE1 |
Yeast replication origin | 2 micron |
Bacterial selection | Ampicillin |
Yeast selection | Tryptophan deficiency |
Quantity | 20ug each, Lyophilized |
Reconstitution | Spin down, add 40ul of nuclease-free water/TE/EB buffer, shaking for 30min at 50°C until completely dissolved. Spin down again. |
Amplification | Transformation into NEB stable competent cells (#C3040), maxiprep. |
Short-term storage | In nuclease-free water or TE, at 4°C |
Long-term storage | Lyophilized DNA at -20°C; E. coli glycerol stock, -80°C |
Table 3. Primers for amplification and sequencing of inserts.
pYSD-C-2u Forward | GTTCTCACCCCTCAACAAC |
pYSD-C-2u Reverse | CGAGCTAAAAGTACAGTGGG |
pYSD-N-2u Forward | CAAAGAATTCCCTACTTCATAC |
pYSD-N-2u Reverse | GCATATAGTTGTCAGTTCCTG |
Table 4. Package contents
Cat. # | Name | Amount |
YD002C | pYSD-C-2u | 20ug |
YD002N | pYSD-N-2u | 20ug |
* YD002 contains two vials, YD002C and YD002N, 20ug each.
References
Map of pYSD-C/N-2u


Sequences are available upon order and request.
- This product is available to nonprofit organizations or for-profit companies.
- Buyers are NOT allowed to transfer or resell this product in any form.
Yeast Display Vectors, high copy (display or secretion)
- Product Code: YD002
- Availability: In Stock
-
$998.00
- Ex Tax: $998.00
Related Products
Yeast Display Vectors, low copy
YSD-C and pYSD-N are yeast display vectors for scFv display on the surface of yeast strain EBY100. p..
$998.00 Ex Tax: $998.00
Yeast Display Vectors, premature stop codon suppressor
YSD-C/N-Leu2 is a derivative of pYSD-C/N, yeast display vector, low copy. In-frame cloning..
$998.00 Ex Tax: $998.00
EBY100 Electrocompetent cells, Library scale
SpecificationsSpeciesS. cerevisiaeStrainEBY100 (ATCC: MYA-4941)Total colonies on YPD plates (400ul)~..
$1,998.00 Ex Tax: $1,998.00
EBY100 Electrocompetent cells, subcloning scale
SpecificationsSpeciesS. cerevisiaeStrainEBY100 (ATCC: MYA-4941)Total colonies on YPD plates (30ul)~ ..
$998.00 Ex Tax: $998.00
BJ5465 Electrocompetent Cells, Subcloning Scale
Note:Yeast display vectors YD001/YD002/YD003, work in EBY100, but not in BJ5465.SpecificationsSpecie..
$998.00 Ex Tax: $998.00
BJ5465 Electrocompetent cells, Library scale
Note:Yeast display vectors YD001/YD002/YD003, work in EBY100, but not in BJ5465.SpecificationsSpecie..
$1,998.00 Ex Tax: $1,998.00






