YSD-C and pYSD-N are yeast display vectors for scFv display on the surface of yeast strain EBY100. pYSD-C/N displays scFv fused to the C/N terminal of AGA2 through GS linker (Figure 1). The vectors with CEN6/ARS4 replication origin at low copies (one copy per cell) and are stable without integration into chromosomes.

Figure 1. Schematic representation of scFv yeast display by pYSD-C and pYSD-N.
Compare flow cytometry of scFv yeast display by three different vectors - pYD1, pYSD-C and pYSD-N, and the results indicated the scFv binding affinity by pYSD-C was highest, followed by pYSD-N and pYD1 (Figure 2 and Table 1). Please be advised the results are based on only one scFv, and different scFvs could lead to different results [1-2].

Figure 2. Flow cytometry test of scFv yeast display by pYD1, pYSD-C and pYSD-N.
Table 1. Flow cytometry analysis of scFv yeast display by pYD1, pYSD-C and pYSD-N.
| Geometric Mean | ||
GFP (display) | APC (binding) | APC/GFP | |
pYD1 | 10857 | 2264 | 0.208529 |
pYSD-C | 11738 | 4793 | 0.408332 |
pYSD-N | 11737 | 2964 | 0.252535 |
Table 2. Specifications of pYSD
Application | Yeast surface display |
Promoter | GAL1 |
Bacterial replication origin | ColE1 |
Yeast replication origin | CEN6/ARS4 |
Bacterial selection | Ampicillin |
Yeast selection | Tryptophan deficiency |
Quantity | 20ug each, Lyophilized |
Reconstitution | Spin down, add 40ul of nuclease-free water/TE/EB buffer, shaking for 30min at 50°C until completely dissolved. Spin down again. |
Amplification | Transformation into NEB stable competent cells (#C3040), maxiprep. |
Short-term storage | In nuclease-free water or TE, at 4°C |
Long-term storage | Lyophilized DNA at -20°C; E. coli glycerol stock, -80°C |
Table 3. Primers for amplification and sequencing of inserts.
pYSD-C Forward | GTTCTCACCCCTCAACAAC |
pYSD-C Reverse | CGAGCTAAAAGTACAGTGGG |
pYSD-N Forward | GATCGAATTCCCTACTTCATAC |
pYSD-N Reverse | GCATATAGTTGTCAGTTCCTG |
Table 4. Package contents
Cat. # | Name | Amount |
YD001C | pYSD-C | 20ug |
YD001N | pYSD-N | 20ug |
References
1. Teymennet-Ramírez KV, Martínez-Morales F, Trejo-Hernández MR. Yeast Surface Display System: Strategies for Improvement and Biotechnological Applications. Front Bioeng Biotechnol. 2022; 9: 794742.
2. Wang Z, Mathias A, Stavrou S, Neville DM Jr. A new yeast display vector permitting free scFv amino termini can augment ligand binding affinities. Protein Eng Des Sel. 2005; 18(7): 337-43.
Map of pYSD-C/N
Sequences are available upon order and request.
- This product is available to nonprofit organizations or for-profit companies.
- Buyers are NOT allowed to transfer or resell this product in any form.
Yeast Display Vectors, low copy
- Product Code: YD001
- Availability: In Stock
-
$998.00
- Ex Tax: $998.00
Related Products
Yeast Display Vectors, premature stop codon suppressor
YSD-C/N-Leu2 is a derivative of pYSD-C/N, yeast display vector, low copy. In-frame cloning..
$998.00 Ex Tax: $998.00
Yeast Display Vectors, high copy (display or secretion)
YSD-C-2u and pYSD-N-2u are yeast display vectors for scFv display on the surface of yeast strain EBY..
$998.00 Ex Tax: $998.00
EBY100 Electrocompetent cells, Library scale
SpecificationsSpeciesS. cerevisiaeStrainEBY100 (ATCC: MYA-4941)Total colonies on YPD plates (400ul)~..
$1,998.00 Ex Tax: $1,998.00
EBY100 Electrocompetent cells, subcloning scale
SpecificationsSpeciesS. cerevisiaeStrainEBY100 (ATCC: MYA-4941)Total colonies on YPD plates (30ul)~ ..
$998.00 Ex Tax: $998.00
BJ5465 Electrocompetent Cells, Subcloning Scale
Note:Yeast display vectors YD001/YD002/YD003, work in EBY100, but not in BJ5465.SpecificationsSpecie..
$998.00 Ex Tax: $998.00
BJ5465 Electrocompetent cells, Library scale
Note:Yeast display vectors YD001/YD002/YD003, work in EBY100, but not in BJ5465.SpecificationsSpecie..
$1,998.00 Ex Tax: $1,998.00








