YSD-C and pYSD-N are yeast display vectors for scFv display on the surface of yeast strain EBY100. pYSD-C/N displays scFv fused to the C/N terminal of AGA2 through GS linker (Figure 1). The vectors with CEN6/ARS4 replication origin at low copies (one copy per cell) and are stable without integration into chromosomes.

Figure 1. Schematic representation of scFv yeast display by pYSD-C and pYSD-N.

Compare flow cytometry of scFv yeast display by three different vectors - pYD1, pYSD-C and pYSD-N, and the results indicated the scFv binding affinity by pYSD-C was highest, followed by pYSD-N and pYD1 (Figure 2 and Table 1). Please be advised the results are based on only one scFv, and different scFvs could lead to different results [1-2].

Figure 2. Flow cytometry test of scFv yeast display by pYD1, pYSD-C and pYSD-N.

Table 1. Flow cytometry analysis of scFv yeast display by pYD1, pYSD-C and pYSD-N.

	Geometric Mean
	GFP (display)	APC (binding)	APC/GFP
pYD1	10857	2264	0.208529
pYSD-C	11738	4793	0.408332
pYSD-N	11737	2964	0.252535

Table 2. Specifications of pYSD

Application	Yeast surface display
Promoter	GAL1
Bacterial replication origin	ColE1
Yeast replication origin	CEN6/ARS4
Bacterial selection	Ampicillin
Yeast selection	Tryptophan deficiency
Quantity	20ug each, Lyophilized
Reconstitution	Spin down, add 40ul of nuclease-free water/TE/EB buffer, shaking for 30min at 50°C until completely dissolved. Spin down again.
Amplification	Transformation into NEB stable competent cells (#C3040), maxiprep.
Short-term storage	In nuclease-free water or TE, at 4°C
Long-term storage	Lyophilized DNA at -20°C; E. coli glycerol stock, -80°C

Table 3. Primers for amplification and sequencing of inserts.

pYSD-C Forward	GTTCTCACCCCTCAACAAC
pYSD-C Reverse	CGAGCTAAAAGTACAGTGGG
pYSD-N Forward	GATCGAATTCCCTACTTCATAC
pYSD-N Reverse	GCATATAGTTGTCAGTTCCTG

Table 4. Package contents

Cat. #	Name	Amount
YD001C	pYSD-C	20ug
YD001N	pYSD-N	20ug

References

1. Teymennet-Ramírez KV, Martínez-Morales F, Trejo-Hernández MR. Yeast Surface Display System: Strategies for Improvement and Biotechnological Applications. Front Bioeng Biotechnol. 2022; 9: 794742.

2. Wang Z, Mathias A, Stavrou S, Neville DM Jr. A new yeast display vector permitting free scFv amino termini can augment ligand binding affinities. Protein Eng Des Sel. 2005; 18(7): 337-43.