YSD-C/N-Leu2 is a derivative of pYSD-C/N, yeast display vector, low copy. In-frame cloning of T2A self-cleaving sequence and Leu2 selection marker into the downstream of expression cassette. If all the cassette is in frame, T2A peptide will be cleavaged [1], the antibody will be displayed on yeast surface, and Leu2 (beta-isopropylmalate dehydrogenase) will stay in yeast cells to synthesize leucine.

Figure 1. Schematic representation of scFv yeast display by pYSD-C/N-Leu2.
The Leu2 gene is deleted in EBY100 cells. Therefore the cells cannot survive unless leucine is available from either plasmid or culture medium. If reading frame shifts or premature stop codons (PSC) exist in the expression cassette, no Leu2 expresses, and the EBY100 cells won’t survive in the leucine-deficient medium. When antibody libraries are synthesized with mixed bases, the majority of clones contain PSC, which cannot normally display protein. The PSC-containing clones will keep growing in the leucine-sufficient medium but not in the leucine-deficient medium (Figure 2).

Figure 2. Flow cytometry analysis of display level of PSC-containing libraries in the leucine-sufficient and leucine-deficient medium. The CDR3 of a nanobody gene was synthesized with 9 mixed codons for affinity maturation. The PSC-containing DNA was cloned into the vector pYSD-C-Leu2. The same library was cultured in the leucine-sufficient medium (Teknova #C9115) and the leucine-deficient medium (Teknova #C9220). (A) The library normally grew in C9115 medium but the display level was 22.7% (anti-V5). (B) The library grew and displayed well in C9220 medium.
One scFv gene was cloned into pYSD-C/N and pYSD-C/N-Leu2 vectors. First, they grew in a tryptophan-deficient medium (Teknova # C8130), then they were induced in C9115 and C9220. pYSD-C/N transformants cannot grow in C9220. pYSD-C/N-Leu2 transformants grew well in the C9220 medium, and the display and binding affinity were not affected (Figure 2).

Figure 3. pYSD-C/N-Leu2 doesn’t affect protein display and binding affinity.
Table 1. Specifications of pYSD-C/N-Leu2
Application | Yeast surface display |
Promoter | TEF1 |
Bacterial replication origin | pBR322 |
Yeast replication origin | 2 micron |
Bacterial selection | Ampicillin |
Yeast selection | Tryptophan, Leucine |
Multiple Cloning Site | NcoI, NdeI, BamHI (Note: there are two KpnI sites in the plasmids) |
Quantity | 20ug each, Lyophilized |
Reconstitution | Spin down, add 40ul of nuclease-free water/TE/EB buffer, shaking for 30min at 50°C until completely dissolved. Spin down again. |
Amplification | Transformation into NEB stable competent cells (#C3040), maxiprep. |
Short-term storage | In nuclease-free water or TE, at 4°C |
Long-term storage | Lyophilized DNA at -20°C; E. coli glycerol stock, -80°C |
Table 2. Primers for amplification and sequencing of inserts.
pYSD-C-Leu2 Forward | GTTCTCACCCCTCAACAAC |
pYSD-C-Leu2 Reverse | GATCTTCTTAGGGGCAGACA |
pYSD-N-Leu2 Forward | GATCGAATTCCCTACTTCATAC |
pYSD-N-Leu2 Reverse | GCATATAGTTGTCAGTTCCTG |
Table 3. Package contents
Cat. # | Name | Amount |
YD003C | pYSD-C-Leu2 | 20ug |
YD003N | pYSD-N-Leu2 | 20ug |
References
1. Chng J, Wang T, Nian R, et al. Cleavage efficient 2A peptides for high level monoclonal antibody expression in CHO cells. MAbs. 2015;7(2):403-12.
Map of pYSD-C/N-Leu2

Sequences are available upon order and request.
- This product is available to nonprofit organizations or for-profit companies.
- Buyers are NOT allowed to transfer or resell this product in any form.
Yeast Display Vectors, premature stop codon suppressor
- Product Code: YD003
- Availability: In Stock
-
$998.00
- Ex Tax: $998.00
Related Products
Yeast Display Vectors, low copy
YSD-C and pYSD-N are yeast display vectors for scFv display on the surface of yeast strain EBY100. p..
$998.00 Ex Tax: $998.00
Yeast Display Vectors, high copy (display or secretion)
YSD-C-2u and pYSD-N-2u are yeast display vectors for scFv display on the surface of yeast strain EBY..
$998.00 Ex Tax: $998.00
EBY100 Electrocompetent cells, Library scale
SpecificationsSpeciesS. cerevisiaeStrainEBY100 (ATCC: MYA-4941)Total colonies on YPD plates (400ul)~..
$1,998.00 Ex Tax: $1,998.00
EBY100 Electrocompetent cells, subcloning scale
SpecificationsSpeciesS. cerevisiaeStrainEBY100 (ATCC: MYA-4941)Total colonies on YPD plates (30ul)~ ..
$998.00 Ex Tax: $998.00
BJ5465 Electrocompetent Cells, Subcloning Scale
Note:Yeast display vectors YD001/YD002/YD003, work in EBY100, but not in BJ5465.SpecificationsSpecie..
$998.00 Ex Tax: $998.00
BJ5465 Electrocompetent cells, Library scale
Note:Yeast display vectors YD001/YD002/YD003, work in EBY100, but not in BJ5465.SpecificationsSpecie..
$1,998.00 Ex Tax: $1,998.00







